Шаблоны LeoTheme для Joomla.
GavickPro Joomla шаблоны

micro banner

  Research Article

 Coagulase-Negative Staphylococci from Hospital-Associated Infections Harboring Virulence Genes

  Wagner Luis Mendes de Oliveira1, Ewerton Lucena Ferreira1, Eduarda Vanessa Cavalcante Mangueira1, Marinalda Anselmo
  Vilela2, Alzira Maria Paiva de Almeida1, Nilma Cintra Leal1*

  1Departamento de Microbiologia, Centro de Pesquisas Aggeu Magalhães / FIOCRUZ – PE, Campus da UFPE, Recife, Pernambuco, Brasil
  2Departamento de Bacteriologia do Hospital Universitário Oswaldo Cruz / UPE, Recife, Pernambuco, Brasil

*Corresponding author: Nilma C. Leal, Departamento de Microbiologia, Centro de Pesquisas Aggeu Magalhães / FIOCRUZ – PE, Campus da UFPE, Recife, Pernambuco, Brasil,
E-mail: nilma@cpqam.fiocruz.br; nilmacleal@gmail.com

Submitted: 09-16-2014 Accepted: 09-22-2014 Published: 10-08-2014

Download PDF

_________________________________________________________________________________________________________________________

 

Article

Abstract

Coagulase-negative staphylococci (CoNS) are frequently isolated from hospital infections associated with biofilm formation on implanted medical devices. However, the toxigenic potential of CoNS is not yet fully understood. Here we report the presence of putative virulence-associated genes usually known for Staphylococcus aureus in CoNS isolates from hospital-associated infections in Recife, Pernambuco, Brazil. The presence of the genes hlgCB, coding for the staphylococcal gamma-hemolysin toxin; lukSF, coding for the Panton-Valentine leukocidin (PVL); and tst, coding for the toxic shock syndrome toxin (TSST-1), was assessed by PCR amplification followed by sequencing of the PCR amplicons in 43 CoNS samples. Preliminary identification by conventional biochemical tests was confirmed by automated system and by sequencing the 16S rRNA and tuf genes. The absence of the coagulase gene in the strains was confirmed by a PCR test that was negative for the coa gene. Eighteen isolates carried at least one of those genes. hlgCB and lukSF were detected together in five isolates, hlgCB occurred alone in 12 isolates, and hlgCB and tst occurred together in one isolate. Carriage of staphylococcal toxigenic genes indicates the ability of CoNS to incorporate those genes, increasing their toxigenic potential and their ability to invade sterile sites and to cause serious hospital-acquired infections.

Keywords:
Coagulase-Negative Staphylococcus; Gamma-Hemolysin; Panton-Valentine Leucocidin; TSST-1

Introduction

Coagulase-negative staphylococci (CoNS), habitual components of the skin and mucosa microflora that were long considered saprophytic, are opportunistic organisms responsible for various infections, especially in hospitalized or immunocompromised patients with prolonged use of implanted medical devices [1-3].

Studies on the virulence mechanisms of CoNS are scarce, and their toxigenic potential is not yet fully understood. CoNS pathogenicity is mainly associated with biofilm formation; although reports on CoNS associated with toxigenic genes are increasing, the toxigenic potential of CoNS strains is still controversial [4-8].

Among Staphylococcus species, Staphylococcus aureus is the best studied. Its association with several virulence factors has been described [7]. Here we report the presence of putative virulence-associated genes usually known for S. aureus in several coagulase negative staphylococcal (CoNS) isolates from nosocomial infections. Detection method was PCR amplification followed by sequencing of the PCR product and the latter confirmed S. aureus sequences.

The presence of the staphylococcal gamma-hemolysin, encoded by the cluster hlgACB; the Panton-Valentine leukocidin (PVL), encoded by the locus lukSF; and the toxic shock syndrome toxin (TSST-1), encoded by the tst gene [9-12], was assessed in methicillin-resistant CoNS strains involved in hospital infections.

Material and methods

Isolates

The study included 43 clinical CoNS isolates from blood culture (n=39) or catheter tips (n=4) that were obtained from patients at Oswaldo Cruz University Hospital in Recife, Pernambuco state, Brazil, from 2002 to 2010 (Table 1). The isolates were characterized as nosocomial infections according to the Centers for Disease Control and Prevention criteria [13], and were preliminary identified by the conventional bacteriological catalase test, the tube coagulase test, the thermonuclease growth test, and the mannitol salt  agar test. All of the samples were methicillin resistant as determined by the presence of the mec gene by PCR [14].

Table 1. Distribution of the CoNS samples by species, source and genes amplified.

micro table 1 mod
ND=not determined; +=positive; -=negative; Vitek=VITEK ® 2 microbial identification system (bioMérieux); 16Sr RNA/tuf=genes sequencing

Identification of the CoNS isolates at the species-level

Identification of the CoNS isolates at the species level was performed using a VITEK ® 2 microbial identification system (bioMérieux SA. 376, Chemin Orme, Marcy l’Etoile, France 69280) and further confirmed by sequencing the 16S rRNA [15] and tuf genes [16]. The coagulase gene was assessed in the strains by a PCR test for the coa gene [17].

Bacterial DNA was extracted as described [18] and quantified using a NanoDrop 2000 (Thermo Fisher Scientific Inc. 81 Wyman Street, Waltham, MA 02451 USA). The amplifications were carried out in individual reactions prepared in a final volume of 25 μl, containing 5 μl Green Go Taq buffer (Promega Corporation. 2800 Woods Hollow Road, Madison, WI 53711 USA), 2.5 mM of each deoxynucleotide, 25 mM MgCl2, 1 U of Go Taq DNA polymerase (Promega),20ng DNA from each sample, and 10 μM of each primer (FTTAGCCGTGGCTTTCTG and R–GCAGGGTGAGTAACAAGT) for the 16S rRNA [15]; (F-GCCAGTTGAGGACGTATTCT and RCCATTTCAGTACCTTGTGGTAA for the tuf gene [16]; and F– ACCACAAGGTACTGAATCAACG and R–TGCTTTCGATTGTTCGATGC for the coa gene (17).

The thermocycler program was 30 cycles of 94°C for 1 min, 57°C for 1 min, and 72°C for 1 min, with a final extension at 72°C for 7 minutes. Amplification products were electrophoresed in 1.5% agarose gels, stained with GelRed Nucleic Acid Stain (Biotium Inc. 3159 Corporate Place, Hayward, CA 94545 USA), visualized on a UV transilluminator, and digitalized using the L-Pix EX Image equipment (Loccus Biotecnologia, 330 José de Andrade, Cotia, SP 06714-200 Brasil).

Sequencing the PCR amplicons


The 16S rRNA and tuf genes amplicons were purified using ExoSAP-IT® (Affymetrix, 3420 Central Expressway, Santa Clara, CA 95051 USA) and sequenced by the Sanger method [19] using a Big Dye® Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems®. 180 Oyster Point Blvd South, San Francisco, CA 94080-1909 USA). The sequences obtained were confirmed bi-directionally and edited with Lasergene 7.0 (DNASTAR Inc. 3801 Regent Street, Madison, WI 53705 USA) and the sequence consensus was compared with sequences deposited in GenBank. The alignments were used to generate phylogenetic trees using Molecular Evolutionary Genetics Analysis (MEGA) software, version 6.0 [20].

The following genome partial sequences were used for phylogenetic analysis: Staphylococcus lugdunensis N920143 (accession number: NC_017353), Staphylococcus haemolyticus JCSC1435 (accession number: NR_074994), Staphylococcus epidermidis RP62A (accession number: NR_074995), Staphylococcus epidermidis ATCC12228  (accession number: NC_004461), Staphylococcus epidermidis SeMCV45 (accession number: HM032776) and Staphylococcus aureus strain UA-S391_USA300 (accession number: CP007690).

Determination of the presence of toxigenic genes
The presence of toxigenic genes coding for gammahemolysin, PVL, and TSST-1 was assessed by PCR using specific primers: hlgCB: GCCAATCCGTTATTAGAAAATGC and CCATAGACGTAGCAACGGAT; lukSF: GCATCAASTGTATTGGATAGCAAAAGC and ATCATTAGGTAAAATGTCTGGACATGATCCA [9]; and tst: AAGCCCTTTGTTGCTTGCG and ATCGAACTTTGGCCCATACTTT [21].

The amplifications were carried out as described above. Amplification products were electrophoresed in 2% agarose gels, stained with GelRed Nucleic Acid Stain (Biotium Inc.), visualized on a UV transilluminator, and digitalized using KODAK 1D software version 3.5.2 (Eastman Kodak Company, 1669 Lake Avenue, Rochester, NY 14652 USA).

Sequencing

The hlgCB, lukSF and tst genes amplicons were purified using ExoSAP-IT® (Affymetrix) and sequenced by the Sanger method [19] using a Big Dye® Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems®). The sequences obtained were processed using SeqMan II from Lasergene 7.0 software package (DNASTAR Inc.) and compared with GenBank sequences using BLAST (http://www.ncbi.nih. gov/BLAST).

Sequences used were: Staphylococcus aureus subsp. aureus MW2 (accession number: BA000033) for hlgCB, Staphylococcus aureus (accession number: L01055) for lukSF and Staphylococcus aureus subsp. aureus N315 (accession number: NC_002745) for tst.

Results

Identification of the CoNS isolates at the species-level Using a VITEK ® 2 microbial identification system (bio- Mérieux) the 18 CoNS isolates harboring toxigenic genes were identified as S. epidermidis (11), S. hominis (3), S. lugdunensis (2), S. haemolyticus (1) and S. xylosus (1). Based on the phylogenetic analysis of the 16S rRNA and tuf genes they were identified as S. epidermidis (15), S. lugdunensis (2) and S. haemolyticus (1) (Table1). The PCR test was negative for the coa gene in all the samples analyzed.

Determination of the presence of toxigenic genes

Out of the 43 CoNS isolates analyzed, 18 (41.86%) has at least one toxigenic gene amplified, and 25 (58.14%) had none.

The 937 base-pair (bp) segment expected for the cluster hlgACB was amplified in 18/43 (41.86%) of the isolates; the segment of 433 bp expected for the cluster lukSF was amplified in 5/43 (11.62%) of the isolates; and the 445 bp segment expected for tst was amplified in one isolate  (2.32%). Figure 1 shows a representative gel of the three segments amplified from either S. lugdunensis 412 and S. epidermidis 45 (Table 1) with the primers targeting hlgCB, lukSF and tst.

micro 12.1

Figure 1. Representative agarose gel showing the amplification products of the expected sizes: 937, 433, and 445 base pairs (bp) with the primers targeting hlgCB, lukSF and tst, respectively. Lanes 1 and 5: DNA 100 bp ladder; Lane 2: hlgCB gene cluster (strain 412); Lane 3: lukSF gene cluster (strain 412); Lane 4: tst gene (strain 45).

Analysis of the sequences revealed 99% identity to the sequences deposited in GenBank: accession number BA000033 for hlgCB, L01055 for lukSF and NC_002745 for tst.

The primers targeting hlgCB and lukSF amplified a product in five isolates (2 S. epidermidis, 2 S. lugdunensis and 1 S. haemolyticus); hlgCB was found alone in 12 S. epidermidis isolates; and hlgCB and tst were found together in one S. epidermidis isolate.

hlgCB was the most prevalent of the three amplicons and was identified in 18/43 (41.86%) isolates. It occurred alone in 12 (66.67%) isolates, combined with lukSF in five (27.77%) and combined with tst in one (5.55%). lukSF occurred only in combination with hlgCB, as did tst.

Discussion

Although CoNS are often responsible for serious infections, resulting mainly from the increasing frequency of invasive procedures [22], their toxigenic potential is not yet clear.

In this work, 18/43 (41.86%) CoNS isolates from blood cultures harbored the hlgCB genes, which code for the staphylococcal gamma-hemolysin. Until now, among the staphylococcal hemolysins, only delta-hemolysin was reported in CoNS [7, 23]. Hence, this is the first time staphylococcal gamma-hemolysin genes were detected in CoNS. The occurrence of this toxin represents an important increase in toxigenic potential, contributing to the emergence of CoNS as a pathogen in the hospital environment.

The presence of lukSF genes, coding for PVL, was detected in 5/43 (11.62%) of the isolates, and they were always present with hlgCB. The presence of lukSF was previously described in CoNS strains of animal origin only [24]. To our knowledge, it has not been detected among human isolates. Thus, this is the first report of lukSF genes in hospital-associated CoNS isolates from blood cultures.

Staphylococcal gamma-hemolysin and PVL act synergistically[9]. In our study, five CoNS strains harbored both hlgCB and lukSF. This association, common in S. aureus, possibly enhances the bacterial invasive and cytotoxic capacity [9, 25].

The tst gene, coding for TSST-1, was detected in only one CoNS isolate. The ability of CoNS to produce TSST-1 has been questioned, and it was speculated that it could be S.aureus that does not express the coagulase enzyme [26-28]. In our work, DNA sequencing of the tst amplicon revealed a tst sequence that was 99% identical to the published S. aureus tst sequence. The isolate was identified as S. epidermidis by 16S rRNA and tuf genes sequencing and its lack of a coagulase gene was confirmed by PCR.

Furthermore, to avoid misdiagnosis and to unambiguously confirm their identification, the 18 CoNS harboring S. aureus toxin genes were typed by sequencing the 16S rRNA and tuf genes. Commercial microbial identification systems may provide ambiguous results or fail to identify isolates with atypical biochemical characteristics [15, 29]. In this work, concordant results were obtained in 14 of 18 CoNS isolates by VITEK ® 2 and 16S rRNA and tuf genes phylogenetic analysis. However, one isolate identified as S. xylosus and three as S. hominis, by VITEK ® 2, revealed S. epidermidis by the 16S rRNA and tuf genes sequencing. Considering molecular identification-based approaches more reliable than the phenotypic-identification methods, the isolates from this study were categorized according to the results of the phylogenetic analysis (Table 1).

All the samples of this study were methicillin resistant [14], as determined by the presence of the mecA gene by PCR.  The treatment of infections by methicillin-resistant strains requires greater attention than other infections because, besides the therapeutic limitations, empirical beta-lactam antibiotic administration can increase the expression of virulence factors such as PVL [25] and induce a high frequency of horizontal transfer of pathogenicity islands carrying genes coding for virulence factors.

In conclusion, our results reveal the toxigenic potential of the CoNS population isolated from blood culture and catheter tips. Although generally considered a simple contaminant, CoNS was found to be an important nosocomial infectious agent acting as a reservoir of virulence genes in the hospital environment. Carriage of staphylococcal toxigenic genes indicates the ability of CoNS to incorporate toxigenic genes, increasing their toxigenic potential and their ability to invade sterile sites
and to cause serious hospital-acquired infections.

Acknowledgments

We thank the Foundation of Science and Technology of the State of Pernambuco (FACEPE) for financial support and the Technology Platform CPqAM/FIOCRUZ/PE for performing the DNA sequencing.

 

References

 References

1.von Eiff C, Peters G, Hellmann C. Pathogenesis of infection due to coagulase negative staphylococci. Lancet Infect. Dis. 2002, 2: 677-685.

2.Garza-González E, Morfin-Otero R, Llaca-Díaz JM, Rodriguez- Noriega E. Staphylococcal cassette chromosome mec (SCCmec) in methicillin-resistant coagulase-negative staphylococci. Epidemiol. Infect. 2010, 138: 645-654.

3.Huebner J, Goldmann DA. Coagulase-negative staphylococci: role as pathogens. Annu. Rev. Med. 1999, 50: 223–236.

4.Rall V L M, Sforcin J M, de Deus M F R, de Sousa D C, Camargo C H et al. Polymerase chain reaction detection of enterotoxin genes in coagulase-negative staphylococci isolated from Brazilian Minas cheese. Foodborne Pathog. 2010, 7: 1121–1123.

5.Calsolari R A O, Pereira V C, Junior J P A, Cunha M L R S. Determination of toxigenic capacity by reverse transcription polymerase chain reaction in coagulase-negative staphylococci and Staphylococcus aureus isolated from newborns in Brazil. Microbiol Immunol. 2011, 55: 394–407.

6.Okee M S, Joloba M L, Okello M, Najjuka F C, Katabazi F A et al. Prevalence of virulence determinants in Staphylococcus epidermidis from ICU patients in Kampala, Uganda. J. Infect. Dev. Ctries. 2012, 12: 242-250.

7.Cunha S, Calsolari O. Toxigenicity in Staphylococcus aureus and coagulase-negative staphylococci : epidemiological and molecular aspects. Microbiol. Insight. 2008, 1: 13–24.

8.Davis M F, Cain C L, Brazil A M, Rankin S C. Two coagulase- negative staphylococci emerging as potential zoonotic pathogens: wolves in sheep’s clothing? Front. Microbiol. 2013, 4: 1-4.

9.Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter M O et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999, 29: 1128-1132.

10.Dinges M M, Orwin P M, Schlievert P M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. 2000, Ver. 13: 16-34.

11.Labandeira-Rey M, Couzon F, Boisset S, Brown E L, Bes M et al. Staphylococcus aureus Panton–Valentine leukocidin causes necrotizing pneumonia. Science. 2007, 315: 1130– 1133.

12.Plata K, Rosato A E, Wegrzyn G. Staphylococcus aureus as an infectious agent: overview of biochemistry and molecular genetics of its pathogenicity. Acta Biochim. Pol. 2009, 56: 597-612.

13.Garner J S. Guideline for isolation precautions in hospitals. Part I. Evolution of isolation practices, hospital infection control practices advisory committee. Am. J. Infect. Control. 1996, 1: 24-31.

14.Aquino R M, Bezerra-Neto A M, Loibman S O, da Costa- Lima J L, Ferreira R L et al. The occurrence and dissemination of methicillin and vancomycin-resistant Staphylococcus in samples from patients and health professionals of a university hospital in Recife, State of Pernambuco, Brazil. Braz J Trop Med. 2014, 47: 437-446.

15.Becker K, Harmsen D, Mellmann A, Meier C, Schumann P et al. Development and evaluation of a quality-controlled ribosomal sequence database for 16S ribosomal DNA-based identification of Staphylococcus species. J. Clin. Microbiol. 2004, 42: 4988-4995.

16.Taponen S, Supré K, Piessens V, Van Coillie E, De Vliegher S et al. Staphylococcus agnetis sp. nov., a coagulase variable species from bovine subclinical and mild clinical mastitis. Int. J. Syst. Evol. Microbiol. 2012, 62: 61-65.

17.Vieira-da-Motta O, Folly M M, Sakyiama C C H. Detection of different Staphylococcus aureus strains in bovine milk from sub clinical mastitis using PCR and routine techniques. Braz. J. Microbiol. 2001, 32: 27-31.

18.De Freitas MFL, Luz I S, Silveira-Filho V M, Júnior J W P, Stamford T L M et al. Staphylococcal toxin genes in strains isolated from cows with subclinical mastitis. Pesq. Vet. Bras. 2008, 28: 617-621.

19.Sanger F, Nicklen S, Coulson R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, Washington. 1977, 74: 5463-5467.

20.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analyses Version 6.0. Mol. Biol. Evol. 2013, 30: 2725-2729.

21.Becker K, Roth R, Peters G. Rapid and specific detection of toxigenic Staphylococcus aureus: Use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal and enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene. J. Clin. Microbiol.1998, 36: 2548-2553.

22.Kloos W E, Bannerman T L. Update on clinical significance of coagulase-negative staphylococci. Clin. Microbiol. Rev. 1994, 7: 117-140.

23.Voung C, Otto M. Staphylococcus epidermidis infections. Microbes Infect. 2002, 4: 481-489

24.Ünal N, Çinar O D. Detection of stapylococcal enterotoxin, methicillin-resistant and Panton–Valentine leukocidin genes in coagulase-negative staphylococci isolated from cows and ewes with subclinical mastitis. Trop. Anim. Health Prod. 2012, 44: 369-375.

25.Novick R P, Schlievert P, Ruzin A. Pathogenicity and resistance islands of staphylococci, Microbes Infect. 2001, 3: 585-594.

26.Victor R, Lachica F, Karl F, Weiss R, Deibel H. Relationships among coagulase, enterotoxin, and heat-stable deoxyribonuclease production by Staphylococcus aureus. Appl Microbiol. 1969, 18: 126-127.

27.Fox L K, Besser T E, Jackson S M. Evaluation of a coagulase-negative variant of Staphylococcus aureus as a cause of intramammary infections in a herd of dairy cattle. J Vet Med Assoc. 1996, 209: 1143-1146.

28.Stevens D L, Ma Y, Salmi D B, Mclndoo E, Wallace R J et al. Impact of antibiotics on expression of virulence associated exotoxin genes in methicillin sensitive and methicillin resistant Staphylococcus aureus. J. Infect. Dis. 2007, 195: 202-211.

29.Shin J H, Kim S H, Jeong H S, Oh S H, Kim H R et al. Identification of coagulase-negative staphylococci isolated from continuous ambulatory peritoneal dialysis fluid using 16s ribosomal rna, tuf, and soda gene sequencing. Perit. Dial. Internat. 2011, 31: 340-346.

Cite this article: Leal N C. Coagulase-Negative Staphylococci from Hospital-Associated Infections Harboring Virulence Genes. J J Microbiol Pathol. 2014, 1(2): 013.

 

Contact Us:
9600 GREAT HILLS
TRAIL # 150 W
AUSTIN, TEXAS
78759 ( TRAVIS COUNTY)
E-mail : info@jacobspublishers.com
Phone : 512-400-0398