Шаблоны LeoTheme для Joomla.
GavickPro Joomla шаблоны

micro banner

 Research Article

Molecular Characterization of Listeria monocytogenes Isolates from Human and Food Samples in Brazil

Nilma Cintra Leal1*, Ana Paula Rocha da Costa1,2, Carina Lucena Mendes-Marques1, Natália Regina Souza da Silva1, Deyse Christina Vallim3, Cristina Barroso Hofer3, Ernesto Hofer3, Alzira Maria Paiva de Almeida1

1Departamento de Microbiologia, Centro de Pesquisas Aggeu Magalhães/FIOCRUZ-PE, Campus da UFPE, Cidade Universitária, Recife, PE, Brazil
2Pós-Graduação em Ciências Biológicas, Universidade Federal de Pernambuco, Campus da UFPE, Cidade Universitária, Recife, PE, Brazil
3Laboratório de Zoonoses Bacterianas, Instituto Oswaldo Cruz/FIOCRUZ, Rio de Janeiro, RJ, Brazil

*Corresponding author: Dr. Nilma Cintra Leal, Departamento de Microbiologia, CPqAM/FIOCRUZ-PE, Campus da UFPE, Cidade Universitária,Recife, PE, Brazil, 50740-465, Tel: 55 81 21012568; Fax: 55 81 21012647;
Email: nilma@cpqam.fiocruz.br

Submitted: 10-09-2014 Accepted: 02-12-2015 Published: 04-15-2015

Download PDF

_________________________________________________________________________________________________________________________

 

Article

Abstract

Listeria monocytogenes is a food-borne disease with high lethality among susceptible individuals. The identification and characterization of the bacterium is required for food industry and commerce microbiology safety, as well as for prevention
and control of the disease. In the present study, we performed a molecular characterization of 135 human (47) and food (88) L. monocytogenes isolates from the serotypes 1/2a, 1/2b, 1/2c, and 4b, which are the serotypes that are the principal cause of human listeriosis and are prevalent in food. PCR amplification of the 23S rRNA sequence confirmed the identification of the strains at the genus level; amplification of the 16S-23S rRNA internal spacer region (ITS-typing) clustered the 135 isolates into three ITS profiles (R1-R3); and most of the L. monocytogenes virulence-associated genes assessed by PCR (inlAB, inlC, inlJ, actA, hly, iap, plcA) were amplified in all of the strains. Statistical analysis did not find significant differences on the distribution of the isolates among the ITS profiles neither between the presence of the genes studied, serotypes and source (human and food) of the isolates. A total of 24 (17.7%) isolates harbored one plasmid each of 50, 63, 70 and 147 kb, the presence of the 63 kb plasmid was statistically higher. This study revealed that food and human isolates share some molecular characteristics suggesting transmission from food to humans. The high frequency of virulence-associated genes among the food-derived strains proves their pathogenic potential and their public health impact. These results emphasize the need to increase the bacterium surveillance and control in foods to avoid exposition to this deadly pathogen.
 

Introduction

Listeria monocytogenes is a food-borne pathogen that iswidespread in the environment worldwide and is the causativeagent of the disease listeriosis, which has a high lethality in susceptible individuals [1, 2].

Listeriosis incidence is increasing worldwide, primarily due to increases in the elderly population and immunocompromisedpredisposed individuals [2]. Furthermore, reports on the presence of L. monocytogenes in a variety of foods ofanimal and vegetable origin, including environmental industrialization areas with spillover to consumers, are alsoincreasing [3].

The species L. monocytogenes harbors a spectrum of strains with varied pathogenic potential, including avirulent strainsthat cause only little harm in the host, to highly pathogenic strains that can cause fatal infections [4, 5]. The pathogenicityof L. monocytogenes involves a multistep pathway thatparticipates in the several steps of the infectious process including invasion of the host cells, escaping from intracellular killing, intracellular multiplication and propagation [6, 7].

Serotyping differentiated 13 L. monocytogenes serotypes [8]. However, most human cases worldwide are attributed to one of only three serotypes (1/2a, 1/2b and 4b); 4b is mainly associated with listeriosis outbreaks and 1/2a and 1/2b serotypes more associated to sporadic events. Among the isolates from food, the serotypes 1/2a, 1/2b, 1/2c and 4b occur more frequently [5].

In Brazil, listeriosis is not a notifiable disease; thus, the cases are underreported and the number of cases remains unknown based on scarce information from a few clinical cases and outbreaks. Furthermore, the molecular characterization of the Brazilian isolates is limited in the literature and is in need of expansion [9].

The present study analyzed L. monocytogenes cultures from clinical samples and food in Brazil to gain additional insight into the virulence potential and genetic diversity of this bacterium. The following approaches were used to reach the objectives: the diversity of the strains was assessed by amplification of the 16S-23S rRNA internal spacer region (ITS-typing or ITS profiles), the presence of L. monocytogenes virulence-associated genes (inlAB, inlC, inlJ, actA, hly, iap, plcA) was determined by PCR regarding serotypes and source (human and food) of the isolates, and the detection of plasmids in the isolates was performed for understanding potential antibiotic resistance.

Material and Methods

Bacterial samples

A total of 135 L. monocytogenes isolates were selected fromthe Listeria Collection (Fiocruz-CLIST) from the Laboratóriode Zoonoses Bacterianas IOC/FIOCRUZ, Rio de Janeiro, Brazil. The selected strains included the most prevalent serotypesfound in humans worldwide (1/2a, 1/2b and 4b), as well as the 1/2c serotype that is more frequent in food, wereisolated from 1975 to 2003 throughout Brazil. Among the strains tested, 47 originated from clinical specimens (cerebrospinalfluid and blood) and 88 from food (dairy products, ham, sausages, meat, pasta, sweets).

Ten Listeria reference strains were used as controls: fourfrom the Center for Disease Control (CDC-USA), three fromthe Listeria Collection of the Institute Pasteur Paris (CLIP) and three from the American Type Culture Collection (ATCC).

Culture conditions and genomic DNA extraction

The cultures were maintained on Tryptose agar (HiMedia Laboratories Pvt Ltd 23, Vadhani Industrial Estate, LBS Marg, Ghatkopar West, Mumbai, Maharashtra 400086, India) stubs at 4ºC and were reactivated by inoculation in brain heart infusion (BHI) broth (HiMedia), incubated at 37°C for 24 h and plated onto 5% sheep blood agar to confirm the purity and assess the hemolytic activity.

DNA samples were extracted following the procedure described by Costa et al [10]: 1 ml of each bacterial culture in BHI was centrifuged for 10 min at 20,000 x g. The resulting pellet was washed with 500 μL of TE (10:1) and 10 μL of 1% lysozyme and 10 μL of 0.5% Proteinase K were added. The samples were incubated at 60°C for 20 min, then, 100 μL of STE (2.5% SDS, 0.25 M EDTA, 10 mM Tris pH 8.0) was added. The samples were incubated at 60°C for 15 min, at room temperature (RT) for 5 min and in an ice bath for 5 min. Then, 130 μL of 7.5 M sodium acetate was added, and the samples were reincubated in an ice bath for 15 min and centrifuged for 3 min at 20,000 x g. Next, 700 μL of the   supernatant was transferred to a new tube, 420 μL of isopropanol was added, and the samples were incubated at -80°C for 30 min and centrifuged at 20,000 x g for 10 min. The supernatant was discarded, and the pellet DNA was vacuum dried
and resuspended in 10 μL of 0.02% RNAse. DNA yield was quantified by comparison with known amounts of λ HindIII DNA (Sigma-Aldrich Co LLC: 3050 Spruce St., St. Louis, MO 63103 USA).

Polymerase chain reaction (PCR)

PCR amplifications were performed as described by Costa et al [10]: the reaction mixtures were prepared in 25 μL volume and included 20 ng of genomic DNA, 50 mM KCl, 10 mM TrisHCl (pH 8.0), 200 mM dNTP (Invitrogen/Life Technologies, Biotechnology Company, Headquarters: Carlsbad, CA, USA), 15 mM MgCl2, 20 pM of each primer and 1U of Taq DNA polymerase (Promega Corporation. 2800 Woods Hollow Road, Madison, WI 53711 USA). Amplifications were performed in a thermocycler (Biometra GmbH: Rudolf-Wissell- Str. 30, 37079 Gottingen, Germany) programmed for 30 cycles of 1 min at 92°C, 1 min at 55°C and 1 min at 72°C followed by a 7 min final extension at 72°C. As a negative control, a tube containing all reagents but genomic DNA was used in each reaction.

Amplification of the 23S rRNA and the 16S-23S rRNA internal spacer region (ITS)

PCR amplification of the 23S rRNA was used to confirm the identification of the strains at the genus level and was performed as described above using the primers designed by Hudson et al [11]: 23S F 5’ GGGGAACCCACTATCTTTAGTC 3’
- 23S R 5’ GGGCCTTTCCAGACCGCTTCA 3`. The diversity of the isolates was assessed by the 16S-23S rRNA (ITS-typing)
analysis using the primers designed by Kostman et al [12]: ITS F 5’ TTGTACACACCGCCCGTCA 3’ - ITS R 5’ GGTACCTTAGATGTTTCAGTTC 3’.

Determination of the presence of virulence-associated genes

The presence of L. monocytogenes virulence-associated genes involved in the various steps of the bacterial infectious process [4] was assessed by PCR amplification followed by sequencing of the PCR amplicons. Reaction reagents and conditions were the same as described by Costa et al [10]. Primers were designed based on sequences described as targeting the genes inlAB: inlAB F 5’ CTACACCACCTTCCGCAAAT 3’; inlAB R 5’ AAAATTCCActCATGCCCAC 3’ [13], actA: actA F 5’ TAGCGTATCACGAGGAGG 3’; actA R 5’ TTTTGAATTTCATATCATTCACC 3’ [13], inlC: inlC F 5’ AAACATCTCGGATCCTTGCTAACATATAAG 3’; inlC R TTTGTCAAGAATTCATTAAGActTAC 3’ [14], inlJ: inlJ F 5’ TGTAACCCCGCTTACACAGTT 3’; inlJ R 5’ AGCGGCTTGGCAGTCTAATA 3’ [15], hly: hly F 5’ GCCTGCAAGTCCTAAGACGCCAATC
3’; hly R 5’ CTTGCAActGCTCTTTAGTAACAGC 3’ [11], iap: iap F 5’ ACA AGC TGC ACC TGT TGC AG 3’; iap R 5’ TGACAGCGTGTGTAGTAGCA 3’[16] and plcA: plcA F 5’ CTGCTTGAGCGTTCATGTCTCATCCCCC 3’; plcA R 5’ CATGGGTTTCActCTCCTTCTAC 3’ [16]. A relatively higher concentration of MgCl2 (1.5 mM) was required for the actA gene PCR reaction.

Reactions included positive controls containing L. monocytogenes reference strains (CDC F4561, CDC F4976, CDC F6254, CDC F45555, CLIP 12612, CLIP 8493, CLIP 11633, ATCC 19115, ATCC 19112, ATCC19119 and a negative control containing all reagents without DNA.

The amplified fragment of each gene was purified and sequenced in an ABI3100 sequencer (Applied Biosystems®. 180 Oyster Point Blvd South, San Francisco, CA 94080-1909 USA). The consensus sequence of each gene was based on the reference strain L. monocytogenes 4b ATCC 19115 and was compared with the published sequences in the National Center for Biotechnology Information (NCBI) using the Basic Local Alignment Tool (BLASTn).

Plasmid profile analysis

Plasmid DNA was isolated following a protocol developed in our laboratory based on a method described by Birnboim and Doly [17]: 1 mL of overnight culture grown in BHI (Hi- Media) broth was centrifuged at 20,000 x g at 4ºC for 10 min. The supernatant was removed; the pellet was washed once with TE (25 mM Tris-HCl, 10 mM EDTA) pH 8.0 and 100 μL of a lysis solution (25 mM Tris HCl pH 8.0, 10 mM EDTA pH 8.0, 4 mg/mL lysozyme, 2% glucose) was added to the pellet. The mixture was homogenized and kept at RT for 10 min, 200 μL of an alkaline solution (0,2 N NaOH, 1% SDS) was  added, the mixture was homogenized by inverting the tubes very softly six times (6x), and the tubes were placed in an ice bath for 10 min. Then, 150 μL of 3 M sodium acetate pH 4.8 was added. The mixture was homogenized by gently inverting the tubes (20x). The tubes were placed in an ice bath for 30 min and then centrifuged for 10 min. Next, 400 μL of the supernatant was transferred to a new tube, and 400 μL of phenol:chloroform:isoamyl alcohol (25:24:01) was added. The mixture was homogenized by gently inverting the tubes (20x) and was then centrifuged for 5 min. The supernatant was removed and the pellet was precipitated with 2 volumes of ethanol (~900 L) at –20ºC for 2 h or –80ºC 30 min. The sample was centrifuged 10 min, and the supernatant was removed. The pellet was vacuum dried and resuspended in 10 μL RNAse (0.1 mg/mL). Then, 1 μL of the sample was electrophoresed in 0.6% agarose gel. Escherichia coli 39R861 plasmid DNA was included as a molecular weight control (147 kb, 63 kb, 35.8 kb and 6.9 kb).

Statistical analysis

Data of ITS typing, presence of plasmids and virulence genesdetection were analyzed by Pearson’s chi-square statistictest using the R software [18]. For the purpose of this work, a p-value of ≤0.05 was considered statistically significant.


Results and Discussion

The interest in Listeria occurrence in foods, particularly L.monocytogenes, has been increasing since the 1980s due toseveral outbreaks and sporadic cases of foodborne listeriosis in Canada, the United States (US) and Europe. The US adopted a “zero tolerance” policy, meaning that the presence ofL. monocytogenes in 25 grams of any type of food product is not acceptable [3, 19].

Bacteriological food control in Brazil does not establish atolerance limit for the presence of L. monocytogenes in food;however, a tolerance limit of the presence of this pathogen has been established in 25 g of several types of cheese.

Even though listeriosis is not a notifiable disease in Brazil,and there is no routine clinical monitoring of L. monocytogenes,many strains are fortuitously isolated from clinical cases and are shipped to the Listeria Reference Center atIOC, FIOCRUZ, RJ for serotyping, as well as numerous food isolates [20].

To further confirm previous identification of the 135 strainsused in this study, each strain was analyzed by PCR amplification of the Listeria-specific 23S rRNA. A segment of theexpected size (239 kb) for the 23S rRNA gene amplified in all samples (data not shown) confirming the preliminary identificationat the genus level.

Subtyping L. monocytogenes strains is crucial in epidemiological investigations to track the source of contaminationfrom food processing plants and to determine the evolutionary relationship between different strains [21]. In the presentstudy the diversity of the strains was assessed by the 16S-23S rRNA, ITS analysis. Low diversity among the isolateswas detected, as expected, for this is a conserved region in prokaryote genomes [22].

The amplification patterns distinguished only three ITSprofiles among the 135 L. monocytogenes isolates: R1, withfragments of 600, 650, 900 and 1000 base pairs (bp); R2, with fragments of 600, 900 and 1000 bp; and R3 with fragments
of 600, 750 and 800 bp (Fig. 1). The R1 profile clustered 49/135 (36.3%) of the isolates, R2 clustered 76/135(56.3%) of the isolates and R3 clustered 10/135 (7.4%) of the isolates (Table 1).

micro fig 17.1

Figure 1. Representative agarose gel showing the 16S - 23S rRNA (ITS) profiles. Lane M: 100-bp DNA ladder. Lanes 1 to 3: R1, R2 and R3 profiles.

micro table 17.1
Table 1. Distribution of the human and food Listeria Monocytogenes strains by serotype and ITS (R1-R3) profiles.

ND = not done, no human 1/2b, 1/2c serogroup strains included

Clinical isolates were evenly distributed between the R1 (40.9%) and R2 (51.1%) profiles only. Food isolates were distributed into the three profiles; most of the isolates fit into the R2 profile (59.1%), followed by R1 (29.5%) and R3 (11.4%). The R3 profile exclusively grouped food isolates.

No significant differences in proportion values were found between ITS profiles, serotypes and source (human and food) of the isolates at significance level of 5%.

Studies using an automated ribotyping system revealed higher discriminatory ability for L. monocytogenes strains [9,23]. This automated technique investigates regions encoding the 16S, 5S and 23S rRNA sequences and the spacer regions, explaining the large number of discriminated profiles.

The determination of the pathogenic potential of L. monocytogenes isolates is essential for effective control of the listeriosis [4]. The presence of virulence-associated genes involved in the main steps of the L. monocytogenes infection pathway inlA, inlB, inlC, inlJ and iap involved in the adhesion and invasion of the host cells; hly and plcA involved in the escaping of the intracellular killing and actA involved in the intracellular multiplication and propagation [4] was assessed by PCR amplification followed by sequencing of the PCR amplicons.

Most of the isolates harbored all of the virulence-associated genes. All 135 strains harbored the hly and inlJ genes. Broadly, the frequency of the inlC, actA, iap and plcA genes were higher among the clinical strains, while the frequency of the inlAB gene was higher among the food strains. Table 2 shows the distribution of the amplified genes by the serotypes and the source of the strains. A comparison of the amplified gene fragment sequences with public sequences revealed 97% to 100% identity, which confirms the identities of these genes. All of the reference strains amplified the expected segments for each gene (data not shown).

micro table 17.2

Table 2. Distribution by serotype of the human and food Listeria monocytogenes strains harboring virulence genes.

ND = not done, no human 1/2b, 1/2c serogroup strains included

Statistical analysis did not find significant differences on the presence of the genes studied, serotypes and source (human
and food) of the isolates.

The role of the L. monocytogenes plasmids in the bacterial pathogenicity or antibiotic resistance remains poorly understood. A higher occurrence of plasmids among food and environmental strains than those from clinical cases has been reported. Some L. monocytogenes plasmids harbor genes involved in heavy metal resistance (cadmium, copper, arsenite), multidrug efflux and oxidative stress response that could contribute to the bacteria fitness and survival in food processing environments [24].

In our study, of the 135 strains, 24 (17.8%) harbored plasmids sized from ~50 to ~147 kb: ~50 kb in four (16.7%) strains; ~63 kb in 16 (66.7%); ~70 kb in two (8.3%) and ~147 kb in two (8.3%) strains. The distribution of the plasmids by size among serotypes and L. monocytogenes isolate origin is shown in Table 3. Regarding the 24 plasmid harboring isolates, the presence of the 63 kb plasmid was statistically higher (p<0,01).

micro table 17.3
Table 3. Distribution by serotype of the human and food Listeria monocytogenes strains of the study harboring plasmids

ND = not done, no human 1/2b, 1/2c serogroup strains included

Because the plasmid-harboring strains did not display antibiotic resistance (data not shown), we can assume that these plasmids are not related to antibiotic resistance. The functions of the plasmids from the strains studied were not determined. Further studies are needed to uncover the role, if any, of the L. monocytogenes plasmids in the bacterial pathogenicity [24].

The results from this study highlighted the need for tightening the surveillance of the food industry, particularly animal products, by the public health authorities aiming to identify and remove these bacteria from food.

Rapid identification and characterization of L. monocytogenes are crucial for the food industry, epidemiological studies, and disease prevention and control. There is a need to develop rapid detection methods for L. monocytogenes in humans and food. Therefore, we developed an efficient procedure for the specific identification of L. monocytogenes and the major pathogenic serotypes of the species based on loop-mediated isothermal amplification (LAMP) [25].

Conclusion

This study provided some new information regarding the molecular characteristics of Brazilian L. monocytogenes isolates. The human and food strains analyzed in this work share several molecular characteristics suggesting transmission of these serotypes from food to humans. The high frequency of known L. monocytogenes virulence-associated genes among food-originated strains demonstrates the pathogenic potential of these isolates, and the human health hazard. This study only tested a small number of strains, which restricted the recognition of more pathogenic serotypes in Brazil. Further studies on the phenotypic and genotypic characteristics of a large number of clinical and food originated strains and other serotypes are needed to better understand the ecology and epidemiology of L. monocytogenes in Brazil.

Acknowledgements


To Dr. Sérgio Paiva for his assistance with the statistical analysis.

References

 References

1.Allerberger A, Wagner M. Listeriosis: a resurgent foodborne infection. Clin Microbiol Infect. 2010, 16(1): 16–23.

2.Tourdjman M, Laurent E, Leclercq A. Listériose humaine: Une zoonose d’origine alimentaire. Rev Francoph Laborat. 2014, 464: 37-44.

3.Hernandez-Milian A, Payeras-Cifre A. What is new in listeriosis? Bio-Med Res. Int. 2014, Article ID 358051, 7 pages.

4.Liu D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol. 2006, 55(6): 645-659.

5.Velge P, Roche SM. Variability of Listeria monocytogenes virulence: a result of the evolution between saprophytism and virulence?. Futur Microbiol. 2010, 5(12): 1799-1821.

6.Liu D, Lawrence ML, Ainsworth AJ, Austin FW. Toward an improved laboratory definition of Listeria monocytogenes virulence. Int J Food Microbiol. 2007, 118(2): 101-115.

7.Cossart P, Lebreton A. A trip in the new microbiology with the bacterial pathogen Listeria monocytogenes. FEBS Lett. 2014, 1(15): 2437-2445.

8.Seeliger PR , Höhne K. Serotyping of Listeria monocytogenes and related species, In: T. Bergan and J. R. Norris (eds) Methods in Microbiology, Academic Press Inc, London, 1979, 13: 31-49.

9.Bueno VF, Banerjee P, Banada PP, de Mesquita AJ, Lemes- Marques EG et al. Characterization of Listeria monocytogenes isolates of food and human origins from Brazil using molecular typing procedures and in vitro cell culture assays. Int J Environ Anal Hlth Res. 2010, 20(1): 43-59.

10.Costa APR, Vilela MA, Mendes-Marques CL, Almeida AMP, Leal NC et al. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures. J Hlth Biol Scien. 2013, 113(67): 116-121.

11.Hudson JA, Lake RJ, Savill MG, Scholes P, McCormick RE et al. Rapid detection of Listeria monocytogenes in ham samples using immunomagnetic separation followed by polymerase chain reaction. J Appl Microbiol. 2001, 90(4): 614-621.

12.Kostman JR, Edlind TD, LiPuma JJ, Stull TL. Molecular epidemiology of Pseudomonas cepacia determined by polymerase chain reaction ribotyping. J Clin Microbiol. 1992, 30(8): 2084-2087.

13.Johnson J, Jinneman K, Stelman G, Smith BG, Lye D et al. Natural atypical Listeria innocua strains with Listeria monocytogenes pathogenicity island 1 genes. Appl Environ Microbiol. 2004, 70(7): 4256-4266.

14.Bergmann B, Raffelsbauer D, Kuhn M, Goetz M, Hom S et al. A- but not InlB-mediated internalization of Listeria monocytogenes by non-phagocytic mammalian cells needs the support of other internalins. Mol Microbiol. 2002, 43(3): 557–570.

15.Liu D, Lawrence ML, Austin FW, Ainsworth AJ. A multiplex PCR for species- and virulence-specific determination of Listeria monocytogenes. J Microbiol Methods. 2007, 71(2): 133-140.

16.Kaur S, Malik SV, Vaidya VM, Barbuddhe SB. Listeria monocytogenes in spontaneous abortions in humans and its detection by multiplex PCR. J Appl Microbiol, 2007, 103(5): 1889-1896.

17.Birnboim HC, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl Ac Res. 1979, 7(6): 1513–1523.

18.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2013.

19.Leclercq A, Charlier C, Lecuit M. Global burden of listeriosis: the tip of the iceberg. The Lancet Infectious Diseases. 2014, 14(11): 1027-1028.

20.Hofer E, Ribeiro R, Feitosa DP. Species and serovars of the genus Listeria isolated from different sources in Brazil. Mem Inst Oswaldo Cruz .2000, 95(5): 615-620.

21.Jadhav S, Bhave M, Palombo EA. Methods used for the detection and subtyping of Listeria monocytogenes. J Microbiol Methods. 2012, 88(3): 327-341.

22.Clarridge III JE. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev. 2004, 17(4): 840–862.

23.Nappi R, Bozzetta E, Serra R, Grattarola C, Decastelli L et al. Molecular characterization of Listeria monocytogenes strains associated with outbreaks of listeriosis in humans and ruminants and food products by serotyping and automated ribotyping. Vet Res Commun. 2005, 2: 249-252.

24.Vivant AL, Garmyn D, Piveteau P. Listeria monocytogenes, a down-to-earth pathogen. Frontiers in Cellular and Infection Microbiology. 2013, 3: 87.

25.da Costa APR, Nunes ML, Mendes-Marques CL, Almeida AMP, Leal NC et al. Loop-Mediated Isothermal Amplification (LAMP) for the Detection of Listeria monocytogenes and Major Pathogenic Serotypes. Americ J Anal Chem .2014, 5(16): 1057-1064.

Cite this article: Leal N C. Molecular Characterization of Listeria monocytogenes Isolates from Human and Food Samples in Brazil. J J Microbiol Pathol. 2015, 1(2): 017.

Contact Us:
9600 GREAT HILLS
TRAIL # 150 W
AUSTIN, TEXAS
78759 ( TRAVIS COUNTY)
E-mail : info@jacobspublishers.com
Phone : 512-400-0398